ID: 1185585043_1185585056

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1185585043 1185585056
Species Human (GRCh38) Human (GRCh38)
Location X:1236495-1236517 X:1236545-1236567
Sequence CCTCTGCCCTCTGGGCCCGTCTG ACGGGCCATGATGACGATGGCGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 3, 3: 37, 4: 550} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!