ID: 1185619254_1185619259

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1185619254 1185619259
Species Human (GRCh38) Human (GRCh38)
Location X:1443370-1443392 X:1443397-1443419
Sequence CCACCATCATGGACACACGCCGC TTGGACACACGCCGCCATCTTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 17, 3: 23, 4: 90} {0: 1, 1: 20, 2: 20, 3: 25, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!