ID: 1185619261_1185619265

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1185619261 1185619265
Species Human (GRCh38) Human (GRCh38)
Location X:1443411-1443433 X:1443435-1443457
Sequence CCATCTTGGACACACACCGCCAT TTGGACAGACACCGCCATCTTGG
Strand - +
Off-target summary No data {0: 2, 1: 19, 2: 23, 3: 33, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!