ID: 1185768688_1185768693

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1185768688 1185768693
Species Human (GRCh38) Human (GRCh38)
Location X:2748128-2748150 X:2748165-2748187
Sequence CCTCTGGCTCTCAAAGTCCTGGG CCACGGTGCCCAGCCAAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 91, 3: 355, 4: 1280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!