ID: 1186266908_1186266911

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1186266908 1186266911
Species Human (GRCh38) Human (GRCh38)
Location X:7843014-7843036 X:7843037-7843059
Sequence CCTGATGGTGCTTTGTGACGTAT AAGGCCTTCCTTCCCGCCCAGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 0, 3: 4, 4: 79} {0: 3, 1: 3, 2: 2, 3: 15, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!