ID: 1186311267_1186311270

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1186311267 1186311270
Species Human (GRCh38) Human (GRCh38)
Location X:8322436-8322458 X:8322452-8322474
Sequence CCCCAAAAACTTAACTACTAATA ACTAATACCCTGCTGTTGACAGG
Strand - +
Off-target summary {0: 71, 1: 314, 2: 487, 3: 492, 4: 692} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!