ID: 1186315144_1186315145

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1186315144 1186315145
Species Human (GRCh38) Human (GRCh38)
Location X:8361491-8361513 X:8361506-8361528
Sequence CCATAAAATTTCTAAAGATAAGA AGATAAGAATCAGCCCCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 63, 4: 636} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!