|
Left Crispr |
Right Crispr |
Crispr ID |
1186324596 |
1186324604 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
X:8465241-8465263
|
X:8465284-8465306
|
Sequence |
CCCGACTTCATCCGCCATGTCCT |
AAGGCCTTCCTTCCCGCCCAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 0, 2: 0, 3: 7, 4: 114} |
{0: 3, 1: 3, 2: 2, 3: 15, 4: 142} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|