ID: 1186324596_1186324607

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1186324596 1186324607
Species Human (GRCh38) Human (GRCh38)
Location X:8465241-8465263 X:8465294-8465316
Sequence CCCGACTTCATCCGCCATGTCCT TTCCCGCCCAGGGCTACCATTGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 7, 4: 114} {0: 2, 1: 4, 2: 1, 3: 5, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!