ID: 1186451307_1186451313

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1186451307 1186451313
Species Human (GRCh38) Human (GRCh38)
Location X:9676127-9676149 X:9676169-9676191
Sequence CCAATTTCCAAATATTGAATCCA GGTGCTGGAGACCACACTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 325} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!