ID: 1186497621_1186497634

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1186497621 1186497634
Species Human (GRCh38) Human (GRCh38)
Location X:10024495-10024517 X:10024523-10024545
Sequence CCCCGAGCCATTCGGTTCTCCCT TCGGAGGAAGGAGGGGTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75} {0: 1, 1: 1, 2: 6, 3: 70, 4: 847}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!