ID: 1186497621_1186497635

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1186497621 1186497635
Species Human (GRCh38) Human (GRCh38)
Location X:10024495-10024517 X:10024528-10024550
Sequence CCCCGAGCCATTCGGTTCTCCCT GGAAGGAGGGGTGAGAGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 47, 3: 505, 4: 4242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!