ID: 1186514532_1186514547

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1186514532 1186514547
Species Human (GRCh38) Human (GRCh38)
Location X:10156779-10156801 X:10156826-10156848
Sequence CCAGCCCCTGAGGGTGGGGCGTC TCTGGACACGAATGCTCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 217} {0: 1, 1: 0, 2: 1, 3: 5, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!