ID: 1186514534_1186514546

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1186514534 1186514546
Species Human (GRCh38) Human (GRCh38)
Location X:10156784-10156806 X:10156825-10156847
Sequence CCCTGAGGGTGGGGCGTCCTGTC CTCTGGACACGAATGCTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128} {0: 1, 1: 0, 2: 2, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!