ID: 1186786335_1186786340

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1186786335 1186786340
Species Human (GRCh38) Human (GRCh38)
Location X:12959458-12959480 X:12959501-12959523
Sequence CCCAGTGGGATAGGAGGAAAATA GTAATCTATCAAACACCTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 0, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!