ID: 1186857458_1186857464

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1186857458 1186857464
Species Human (GRCh38) Human (GRCh38)
Location X:13639891-13639913 X:13639932-13639954
Sequence CCCTCCACTCCTCTGCCACACAG AGCCAAGTAGTGAGAATCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!