ID: 1186937117_1186937122

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1186937117 1186937122
Species Human (GRCh38) Human (GRCh38)
Location X:14462969-14462991 X:14463002-14463024
Sequence CCATCTTTGTGGTTTTATCTACC GATGTTGGTGACCTACAATTGGG
Strand - +
Off-target summary {0: 2345, 1: 4257, 2: 1105, 3: 370, 4: 436} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!