ID: 1187354755_1187354759

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1187354755 1187354759
Species Human (GRCh38) Human (GRCh38)
Location X:18557458-18557480 X:18557489-18557511
Sequence CCCTCTATATCCTCGTAGATACT ACTGTTATAACCTTTTGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 68} {0: 1, 1: 0, 2: 1, 3: 30, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!