ID: 1187595632_1187595636

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1187595632 1187595636
Species Human (GRCh38) Human (GRCh38)
Location X:20769509-20769531 X:20769556-20769578
Sequence CCCCCAAACTGCAGAATACATAT ACCAAAATAGACCATATGCCAGG
Strand - +
Off-target summary No data {0: 2, 1: 6, 2: 37, 3: 259, 4: 1309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!