ID: 1187698182_1187698194

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1187698182 1187698194
Species Human (GRCh38) Human (GRCh38)
Location X:21941157-21941179 X:21941192-21941214
Sequence CCTGGCCGTCCACCCGCGCTCCC CGCCTTCGCGCTCCCGCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 308} {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!