ID: 1187698189_1187698202

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1187698189 1187698202
Species Human (GRCh38) Human (GRCh38)
Location X:21941177-21941199 X:21941215-21941237
Sequence CCCACGCGGGCTCGCCGCCTTCG AGTCCCCGGGCTGCCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51} {0: 1, 1: 0, 2: 2, 3: 30, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!