ID: 1187698190_1187698201

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1187698190 1187698201
Species Human (GRCh38) Human (GRCh38)
Location X:21941178-21941200 X:21941210-21941232
Sequence CCACGCGGGCTCGCCGCCTTCGC CGGGGAGTCCCCGGGCTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140} {0: 1, 1: 0, 2: 2, 3: 24, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!