ID: 1187823804_1187823813

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1187823804 1187823813
Species Human (GRCh38) Human (GRCh38)
Location X:23315073-23315095 X:23315104-23315126
Sequence CCCATTTCAACCAGACCAAAATC TCCGTGGCCCTCTGAGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!