ID: 1187836320_1187836323

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1187836320 1187836323
Species Human (GRCh38) Human (GRCh38)
Location X:23435643-23435665 X:23435663-23435685
Sequence CCCAACTCCAGGCAGCTCAGCAC CACAGAGAAAGAGACTGTTTAGG
Strand - +
Off-target summary {0: 5, 1: 73, 2: 194, 3: 307, 4: 802} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!