ID: 1187836321_1187836323

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1187836321 1187836323
Species Human (GRCh38) Human (GRCh38)
Location X:23435644-23435666 X:23435663-23435685
Sequence CCAACTCCAGGCAGCTCAGCACA CACAGAGAAAGAGACTGTTTAGG
Strand - +
Off-target summary {0: 6, 1: 70, 2: 181, 3: 302, 4: 721} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!