ID: 1187836322_1187836323

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1187836322 1187836323
Species Human (GRCh38) Human (GRCh38)
Location X:23435650-23435672 X:23435663-23435685
Sequence CCAGGCAGCTCAGCACAGAGAAA CACAGAGAAAGAGACTGTTTAGG
Strand - +
Off-target summary {0: 7, 1: 71, 2: 190, 3: 340, 4: 673} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!