ID: 1187996155_1187996161

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1187996155 1187996161
Species Human (GRCh38) Human (GRCh38)
Location X:24929127-24929149 X:24929177-24929199
Sequence CCTGCACCAAATTGGGTTGGCTA GGATCCTTGGATCTAATACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 45} {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!