ID: 1188559913_1188559918

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1188559913 1188559918
Species Human (GRCh38) Human (GRCh38)
Location X:31455918-31455940 X:31455934-31455956
Sequence CCTGGGCTCTACTACCAAATTGG AAATTGGTTAGGCTTGGCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 102} {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!