ID: 1188559913_1188559921

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1188559913 1188559921
Species Human (GRCh38) Human (GRCh38)
Location X:31455918-31455940 X:31455941-31455963
Sequence CCTGGGCTCTACTACCAAATTGG TTAGGCTTGGCATAGGACCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 102} {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!