ID: 1188712528_1188712531

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1188712528 1188712531
Species Human (GRCh38) Human (GRCh38)
Location X:33418156-33418178 X:33418172-33418194
Sequence CCAAACTGGGAAAGACACTTATA ACTTATAGACTGAAGGTAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!