ID: 1188723541_1188723545

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1188723541 1188723545
Species Human (GRCh38) Human (GRCh38)
Location X:33551975-33551997 X:33552004-33552026
Sequence CCAGAGAAGCTCTGCTGTGCTAA TCTTCCATTCCCAGTTGGTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 24, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!