ID: 1188796821_1188796823

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1188796821 1188796823
Species Human (GRCh38) Human (GRCh38)
Location X:34477235-34477257 X:34477266-34477288
Sequence CCATTGCTAGCTGTATTTGTAAG TTTTTTAAGGCAATTGTGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 113, 3: 1020, 4: 11769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!