ID: 1188864548_1188864551

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1188864548 1188864551
Species Human (GRCh38) Human (GRCh38)
Location X:35299435-35299457 X:35299470-35299492
Sequence CCATGCACTTGAGGAACGGAGAG AGGGAAATTACCCATCCTAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!