ID: 1189015757_1189015759

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1189015757 1189015759
Species Human (GRCh38) Human (GRCh38)
Location X:37094891-37094913 X:37094905-37094927
Sequence CCTTAGTGATTTCCTTAGCTTCA TTAGCTTCAACTCTTAGAAGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 19, 4: 205} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!