ID: 1189112771_1189112777

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1189112771 1189112777
Species Human (GRCh38) Human (GRCh38)
Location X:38310574-38310596 X:38310625-38310647
Sequence CCACAGAACGCAGGGAACAGAAC CACAGTATGCTCTCCACCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163} {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!