ID: 1189129117_1189129118

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1189129117 1189129118
Species Human (GRCh38) Human (GRCh38)
Location X:38480064-38480086 X:38480093-38480115
Sequence CCTTGTGATCTTGAGTAGGGCGC GTTTTCTCATTGTGTCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86} {0: 1, 1: 0, 2: 9, 3: 42, 4: 461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!