ID: 1189259106_1189259117

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1189259106 1189259117
Species Human (GRCh38) Human (GRCh38)
Location X:39665108-39665130 X:39665152-39665174
Sequence CCTTTCCTCTGCCTTTTTATTCC GATGGTGCCTGTCCATGTTGAGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 156, 3: 407, 4: 1459} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!