ID: 1189259114_1189259117

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1189259114 1189259117
Species Human (GRCh38) Human (GRCh38)
Location X:39665139-39665161 X:39665152-39665174
Sequence CCCCAGCTGATTGGATGGTGCCT GATGGTGCCTGTCCATGTTGAGG
Strand - +
Off-target summary {0: 19, 1: 43, 2: 109, 3: 237, 4: 556} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!