ID: 1189590461_1189590464

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1189590461 1189590464
Species Human (GRCh38) Human (GRCh38)
Location X:42505742-42505764 X:42505768-42505790
Sequence CCTGTATTTTACAGAGGCTCTGA ATTTGGAAGCAGAATGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 48, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!