ID: 1189998430_1189998435

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1189998430 1189998435
Species Human (GRCh38) Human (GRCh38)
Location X:46661614-46661636 X:46661640-46661662
Sequence CCACATAACACCATGTGGCCGGG AGCAGTTGGCAGCAGCTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66} {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!