ID: 1190044552_1190044556

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1190044552 1190044556
Species Human (GRCh38) Human (GRCh38)
Location X:47101510-47101532 X:47101547-47101569
Sequence CCAGTTTATCACATGGAGGAGGC ACCCCATGGGATGACCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!