ID: 1190285297_1190285322

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1190285297 1190285322
Species Human (GRCh38) Human (GRCh38)
Location X:48957456-48957478 X:48957508-48957530
Sequence CCACGCCCACACCTCCGCCGCGC CGGCGGCTCGTTGGCGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 467} {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!