ID: 1190311856_1190311867

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1190311856 1190311867
Species Human (GRCh38) Human (GRCh38)
Location X:49122555-49122577 X:49122587-49122609
Sequence CCACTCTATCCTTCCACCTTCTT CCTTCAATGGGGAAGGGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 76, 4: 1003} {0: 1, 1: 0, 2: 0, 3: 12, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!