ID: 1190413054_1190413059

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1190413054 1190413059
Species Human (GRCh38) Human (GRCh38)
Location X:50156124-50156146 X:50156154-50156176
Sequence CCACCTCCTGCTCATCTGCTTCA TCCCTATGGTGTCGGTGTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!