ID: 1190543963_1190543965 |
View in Genome Browser |
Spacer: -1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1190543963 | 1190543965 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:51505700-51505722 | X:51505722-51505744 |
| Sequence | CCTTGTGAAGGGATAAAATGATT | TGGTACTTACAGCTGCTTCAAGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||