ID: 1190604978_1190604980

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1190604978 1190604980
Species Human (GRCh38) Human (GRCh38)
Location X:52131794-52131816 X:52131826-52131848
Sequence CCATTCACAATAGCCATAAAAAC CATAGAAATACAGCTAGCCATGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 227, 3: 1091, 4: 3008} {0: 1, 1: 3, 2: 108, 3: 782, 4: 2214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!