ID: 1190970093_1190970098

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1190970093 1190970098
Species Human (GRCh38) Human (GRCh38)
Location X:55340338-55340360 X:55340382-55340404
Sequence CCCTCTAGAGAACGCTGACTAAT GCAGCCATGTTAACTGCAACAGG
Strand - +
Off-target summary {0: 22, 1: 909, 2: 1154, 3: 769, 4: 555} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!