ID: 1190970094_1190970098

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1190970094 1190970098
Species Human (GRCh38) Human (GRCh38)
Location X:55340339-55340361 X:55340382-55340404
Sequence CCTCTAGAGAACGCTGACTAATA GCAGCCATGTTAACTGCAACAGG
Strand - +
Off-target summary {0: 22, 1: 931, 2: 1204, 3: 835, 4: 522} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!