ID: 1191213186_1191213195

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1191213186 1191213195
Species Human (GRCh38) Human (GRCh38)
Location X:57910005-57910027 X:57910039-57910061
Sequence CCCTGCGCAGAGCAGCCCGCGGG TCTCGTCCCCCTGGAGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 171} {0: 1, 1: 1, 2: 2, 3: 22, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!