ID: 1191213190_1191213200

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1191213190 1191213200
Species Human (GRCh38) Human (GRCh38)
Location X:57910020-57910042 X:57910049-57910071
Sequence CCCGCGGGGTTCGCGCCGCTCTC CTGGAGCCCCGGGCCCGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 61, 4: 2314} {0: 1, 1: 1, 2: 2, 3: 39, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!